ID: 942098598

View in Genome Browser
Species Human (GRCh38)
Location 2:172556372-172556394
Sequence CTTTTTGCGCGGTCCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942098582_942098598 26 Left 942098582 2:172556323-172556345 CCATGAAGCAGTTCCTGGACTTC 0: 1
1: 2
2: 1
3: 27
4: 241
Right 942098598 2:172556372-172556394 CTTTTTGCGCGGTCCCGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 37
942098590_942098598 -8 Left 942098590 2:172556357-172556379 CCCGGGACCTTGGGCCTTTTTGC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 942098598 2:172556372-172556394 CTTTTTGCGCGGTCCCGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 37
942098585_942098598 13 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098598 2:172556372-172556394 CTTTTTGCGCGGTCCCGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 37
942098591_942098598 -9 Left 942098591 2:172556358-172556380 CCGGGACCTTGGGCCTTTTTGCG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 942098598 2:172556372-172556394 CTTTTTGCGCGGTCCCGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942098598 Original CRISPR CTTTTTGCGCGGTCCCGGGC GGG Intronic