ID: 942098600

View in Genome Browser
Species Human (GRCh38)
Location 2:172556381-172556403
Sequence CGGTCCCGGGCGGGGAGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942098590_942098600 1 Left 942098590 2:172556357-172556379 CCCGGGACCTTGGGCCTTTTTGC 0: 1
1: 0
2: 1
3: 6
4: 137
Right 942098600 2:172556381-172556403 CGGTCCCGGGCGGGGAGCTGCGG 0: 1
1: 0
2: 3
3: 25
4: 294
942098591_942098600 0 Left 942098591 2:172556358-172556380 CCGGGACCTTGGGCCTTTTTGCG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 942098600 2:172556381-172556403 CGGTCCCGGGCGGGGAGCTGCGG 0: 1
1: 0
2: 3
3: 25
4: 294
942098593_942098600 -6 Left 942098593 2:172556364-172556386 CCTTGGGCCTTTTTGCGCGGTCC 0: 1
1: 0
2: 0
3: 0
4: 36
Right 942098600 2:172556381-172556403 CGGTCCCGGGCGGGGAGCTGCGG 0: 1
1: 0
2: 3
3: 25
4: 294
942098585_942098600 22 Left 942098585 2:172556336-172556358 CCTGGACTTCGGTGAGTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 67
Right 942098600 2:172556381-172556403 CGGTCCCGGGCGGGGAGCTGCGG 0: 1
1: 0
2: 3
3: 25
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942098600 Original CRISPR CGGTCCCGGGCGGGGAGCTG CGG Intronic