ID: 942102875

View in Genome Browser
Species Human (GRCh38)
Location 2:172603423-172603445
Sequence CCTGATAATTGGCTAATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942102872_942102875 3 Left 942102872 2:172603397-172603419 CCAGTGAACATATAACTAGTGGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 942102875 2:172603423-172603445 CCTGATAATTGGCTAATGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 95
942102870_942102875 4 Left 942102870 2:172603396-172603418 CCCAGTGAACATATAACTAGTGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 942102875 2:172603423-172603445 CCTGATAATTGGCTAATGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942102875 Original CRISPR CCTGATAATTGGCTAATGCA AGG Intronic
900839368 1:5035416-5035438 CCTAGTCATGGGCTAATGCATGG - Intergenic
905830015 1:41058162-41058184 CCTAATAATGGGCCAATGAAAGG - Intronic
905894879 1:41539148-41539170 CCTGAAAATGGCCTAATCCAAGG - Intronic
907923517 1:58934724-58934746 CTTCATAATTGTCCAATGCAGGG - Intergenic
909824417 1:80109335-80109357 CCAGATAAATAGCTAATGCATGG + Intergenic
911460654 1:98185472-98185494 TCTGATAATTAGCAATTGCAAGG + Intergenic
917689826 1:177457386-177457408 CCTTACAACTGGCTAATGAAAGG - Intergenic
918255717 1:182744931-182744953 ACTCATAATTGCCTAAGGCAAGG - Intergenic
918870291 1:189963844-189963866 GCTAATAAATGGCTAATGGAAGG - Intergenic
919235497 1:194836934-194836956 CCTGAGAATGGACTAATACAAGG + Intergenic
920874801 1:209824676-209824698 CTTGAAAATTGGCAAATGAAGGG + Intergenic
924521132 1:244807183-244807205 GCTGAAAATTGGCAAATGAAAGG + Intergenic
1063266369 10:4455673-4455695 CATAATATTTGGCTGATGCATGG - Intergenic
1063543553 10:6958215-6958237 CCTGCTGATTGGCCAATGCCTGG + Intergenic
1065781430 10:29171867-29171889 CCTTTTAATTTGCAAATGCAGGG + Intergenic
1066270009 10:33813188-33813210 CATGACAATAGGCTAATACAGGG - Intergenic
1069219903 10:65870058-65870080 CAGGATAAATAGCTAATGCATGG + Intergenic
1080812298 11:35716697-35716719 CCTGATAACTGCCTAAATCATGG + Intronic
1082815344 11:57504346-57504368 GCTAATAATTGGGTAAAGCAGGG - Intronic
1084488225 11:69463519-69463541 CCTAAGGATTGGCTAAGGCAGGG + Intergenic
1086233281 11:84596069-84596091 CCTTAAAATTAGCTAATGCTAGG - Intronic
1087268608 11:96087922-96087944 CCTTATAATTGTCCAATGAAAGG - Intronic
1088078861 11:105885083-105885105 CCTGCTATTTGGCTACAGCAGGG - Intronic
1090058175 11:123441122-123441144 CCTGAAAATGGACTAATACAGGG + Intergenic
1090558468 11:127902499-127902521 CCTGCTAATTGGATCATGGATGG - Intergenic
1095802357 12:46281905-46281927 CCTGATAATGCGCTCAGGCATGG - Intergenic
1096534832 12:52264864-52264886 CCTGCTTATAGGCTATTGCAAGG + Intronic
1097908622 12:64946136-64946158 CCGGATAACTGGATAATGAAGGG - Intergenic
1099994633 12:89764831-89764853 CAGGATAAATAGCTAATGCATGG + Intergenic
1109497242 13:63189085-63189107 CCTGATAATAGGATAATGTTTGG + Intergenic
1110081085 13:71313583-71313605 GCTGATCATTGGATAATGCTTGG + Intergenic
1112941935 13:104873982-104874004 CTTTCTAATTGGCTACTGCAGGG - Intergenic
1115349090 14:32373829-32373851 ACTGACAATTAGCTAATGCTTGG - Intronic
1120008728 14:79389087-79389109 CATGAGAACTGACTAATGCAGGG + Intronic
1123398868 15:19964420-19964442 CATGATAATGGACTAATACAGGG + Intergenic
1124855324 15:33382055-33382077 GATGATAATTGGCCAATGAAAGG + Intronic
1130612501 15:85374128-85374150 ATTGATAATTGACAAATGCAGGG - Intergenic
1131712089 15:95067214-95067236 CCTGAAAATGGACTAATACACGG - Intergenic
1131859640 15:96638852-96638874 CTGGATAATTGGCTATGGCAGGG + Intergenic
1132462029 16:60278-60300 CCACATACTTGGCTCATGCAGGG - Exonic
1133424333 16:5674673-5674695 CCTAATACGTGGCGAATGCATGG + Intergenic
1137538466 16:49345257-49345279 CCTCATTATCAGCTAATGCATGG - Intergenic
1144421584 17:15103957-15103979 CTTGATAATAGGCTACTGGATGG - Intergenic
1150490611 17:65571918-65571940 CAGGATAAATAGCTAATGCATGG + Intronic
1158112653 18:53958281-53958303 ACTCATCATTGGCTTATGCATGG + Intergenic
1158680759 18:59564790-59564812 GCTGATCATTTGCTAATGCAGGG + Intronic
1159888363 18:73931999-73932021 CATGAGAATGGGCTAATACAGGG + Intergenic
1166127466 19:40724105-40724127 CCAGTTAATTGGCCAAAGCAAGG + Intronic
926962950 2:18378844-18378866 GCCAATAATTGGCCAATGCAGGG - Intergenic
930767765 2:55102631-55102653 CCTGCTAATAGGCCAGTGCATGG + Intronic
933346946 2:81099485-81099507 GCTGATCATTGAATAATGCAGGG + Intergenic
934739478 2:96709376-96709398 CTTGAGAAATGGCTGATGCAGGG - Intronic
939820753 2:146954470-146954492 AATGCTAATAGGCTAATGCAGGG + Intergenic
940491952 2:154373775-154373797 CCTGTTAAGTGGCTATTACAAGG - Intronic
941850910 2:170179094-170179116 CAGGATAAATAGCTAATGCATGG + Intronic
942102875 2:172603423-172603445 CCTGATAATTGGCTAATGCAAGG + Intronic
942777896 2:179607056-179607078 CCTGATTTTTGGCTTATCCAGGG + Intronic
1175458981 20:59136648-59136670 CCTGATATTTGGCTCATTCTAGG + Intergenic
1176745552 21:10649154-10649176 CATGATAATGGACTAATACAGGG + Intergenic
1177849690 21:26331747-26331769 CCTCATAATATGTTAATGCAGGG + Intergenic
1178548009 21:33510022-33510044 CCTGAAAATAAGATAATGCAAGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954977130 3:54706843-54706865 CATGACAATTGGCCTATGCAGGG - Intronic
959022614 3:101204920-101204942 CCTGATAATTAGCAAAAGAATGG + Intergenic
960384616 3:117007136-117007158 CAGGATAAATAGCTAATGCATGG - Intronic
962276639 3:134019682-134019704 CCTGCTAATGGGATGATGCAGGG - Intronic
963674741 3:148295791-148295813 CCTGAGAATGGACTAATACAGGG + Intergenic
968834901 4:2955880-2955902 TCTGATATTTGGCTAATCCAGGG - Intronic
975036312 4:69687435-69687457 CGTGATAATGGACTAATACAGGG - Intergenic
975419105 4:74141231-74141253 CGAGATAATTGGCTTAAGCAGGG + Intronic
976208744 4:82646310-82646332 CCTGACAGTTTGCAAATGCATGG + Intronic
978095487 4:104770909-104770931 ATTGATAATTGGCTAATATAAGG - Intergenic
978439756 4:108721223-108721245 CCTCATCATTGGTTCATGCATGG + Intergenic
979542510 4:121901483-121901505 TCAGATAATTTGCTTATGCAAGG - Intronic
980689875 4:136281437-136281459 CCTTATAATATGCAAATGCACGG + Intergenic
982480513 4:155903633-155903655 CATGCTGATTGGCTGATGCAGGG + Intronic
985154845 4:186976281-186976303 CCTGATGATTGTCTCATTCAAGG - Intergenic
987815987 5:22901655-22901677 CCTGCTAATTGGTCTATGCACGG + Intergenic
990122775 5:52475823-52475845 CATGAGAATTGGCTAATACATGG + Intergenic
992735367 5:79713989-79714011 CCTGATAATTGGCTAACGGTGGG - Intronic
1002347706 5:178559311-178559333 CCGGACACTTGGCTAATGGAAGG + Intronic
1011080517 6:83485783-83485805 CAGGATAAATAGCTAATGCATGG + Intergenic
1012600832 6:101094666-101094688 GCTGATAATTGGCTAATAAAAGG - Intergenic
1015228803 6:130889606-130889628 CATGAAAATTTGCTGATGCAGGG + Intronic
1016160472 6:140873377-140873399 CCTGAGAACTGGTAAATGCAGGG + Intergenic
1020466778 7:8489035-8489057 CGTGATGATTTGCAAATGCAAGG - Intronic
1021570378 7:22059090-22059112 GCTGATAATAGACTAATACAAGG - Intergenic
1022863099 7:34388371-34388393 CATGAGAATGGGCTAATGAAAGG + Intergenic
1023735309 7:43230932-43230954 CCTGATGATGTGCTAATGCTTGG - Intronic
1031539351 7:122974773-122974795 CCTGAAAATTGGTTAATGTTGGG + Intergenic
1031759865 7:125699113-125699135 CCTTATAAGTTGCTAATGGAAGG + Intergenic
1038024397 8:23575991-23576013 CCTGAGACCTGGCCAATGCAGGG + Intergenic
1039313623 8:36347589-36347611 CATGAGAATGGGCTAATACATGG - Intergenic
1044629943 8:94268817-94268839 CATTATAATTGGCTAAATCAAGG - Intergenic
1046623880 8:116556925-116556947 CCAGAAAATTGGCTAAGGGATGG - Intergenic
1055294456 9:74820127-74820149 CAGGATAAATAGCTAATGCATGG - Intronic
1056325692 9:85476370-85476392 CATGAGAATGGGCTAATACATGG + Intergenic
1057636089 9:96769028-96769050 CCTAATAAATGGCCAATGTATGG - Intronic
1059013766 9:110492457-110492479 ACAGATAATTGGGTAATGAAAGG + Intronic
1193959515 X:87907086-87907108 CAAGATAAATAGCTAATGCATGG + Intergenic
1196062689 X:111428128-111428150 GCCAATAATTGGCTAAGGCATGG - Intergenic
1196779720 X:119372945-119372967 CAGGATAAATAGCTAATGCATGG + Intergenic