ID: 942103944

View in Genome Browser
Species Human (GRCh38)
Location 2:172614116-172614138
Sequence AGATTCCCGGGTTCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942103944_942103949 -1 Left 942103944 2:172614116-172614138 CCAGGTGTAGAACCCGGGAATCT No data
Right 942103949 2:172614138-172614160 TCTGCAGCCTGTGCCCTCAGGGG No data
942103944_942103951 6 Left 942103944 2:172614116-172614138 CCAGGTGTAGAACCCGGGAATCT No data
Right 942103951 2:172614145-172614167 CCTGTGCCCTCAGGGGTCCCAGG No data
942103944_942103948 -2 Left 942103944 2:172614116-172614138 CCAGGTGTAGAACCCGGGAATCT No data
Right 942103948 2:172614137-172614159 CTCTGCAGCCTGTGCCCTCAGGG No data
942103944_942103947 -3 Left 942103944 2:172614116-172614138 CCAGGTGTAGAACCCGGGAATCT No data
Right 942103947 2:172614136-172614158 TCTCTGCAGCCTGTGCCCTCAGG No data
942103944_942103952 10 Left 942103944 2:172614116-172614138 CCAGGTGTAGAACCCGGGAATCT No data
Right 942103952 2:172614149-172614171 TGCCCTCAGGGGTCCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942103944 Original CRISPR AGATTCCCGGGTTCTACACC TGG (reversed) Intergenic
No off target data available for this crispr