ID: 942104030

View in Genome Browser
Species Human (GRCh38)
Location 2:172614451-172614473
Sequence CGGGATGACCAGCTGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942104025_942104030 9 Left 942104025 2:172614419-172614441 CCTGGGCTCAGCCAGAGCAGGGC 0: 30
1: 69
2: 103
3: 202
4: 674
Right 942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG No data
942104023_942104030 10 Left 942104023 2:172614418-172614440 CCCTGGGCTCAGCCAGAGCAGGG 0: 32
1: 59
2: 94
3: 161
4: 535
Right 942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG No data
942104021_942104030 19 Left 942104021 2:172614409-172614431 CCGTAAAAGCCCTGGGCTCAGCC 0: 65
1: 121
2: 262
3: 300
4: 619
Right 942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG No data
942104027_942104030 -2 Left 942104027 2:172614430-172614452 CCAGAGCAGGGCAGAGGATGACG No data
Right 942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942104030 Original CRISPR CGGGATGACCAGCTGCAGAG AGG Intergenic
No off target data available for this crispr