ID: 942108996

View in Genome Browser
Species Human (GRCh38)
Location 2:172661401-172661423
Sequence CTGCTGTTCTTGAGGTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942108994_942108996 9 Left 942108994 2:172661369-172661391 CCATCAATTCTTAATTGTCTTAC No data
Right 942108996 2:172661401-172661423 CTGCTGTTCTTGAGGTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942108996 Original CRISPR CTGCTGTTCTTGAGGTTATT TGG Intergenic
No off target data available for this crispr