ID: 942111554

View in Genome Browser
Species Human (GRCh38)
Location 2:172687862-172687884
Sequence CTTTGTGTTCAGTGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942111554_942111557 -9 Left 942111554 2:172687862-172687884 CCTGCTGCCCACTGAACACAAAG No data
Right 942111557 2:172687876-172687898 AACACAAAGACTTCCAAGTGAGG No data
942111554_942111560 21 Left 942111554 2:172687862-172687884 CCTGCTGCCCACTGAACACAAAG No data
Right 942111560 2:172687906-172687928 AGCCATAGATTGCAGTTCAGTGG No data
942111554_942111558 -6 Left 942111554 2:172687862-172687884 CCTGCTGCCCACTGAACACAAAG No data
Right 942111558 2:172687879-172687901 ACAAAGACTTCCAAGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942111554 Original CRISPR CTTTGTGTTCAGTGGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr