ID: 942114646

View in Genome Browser
Species Human (GRCh38)
Location 2:172716041-172716063
Sequence AAATTGCCACAGATTTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942114643_942114646 24 Left 942114643 2:172715994-172716016 CCAGAGAACATTTCATTAGATTA No data
Right 942114646 2:172716041-172716063 AAATTGCCACAGATTTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942114646 Original CRISPR AAATTGCCACAGATTTATAA AGG Intergenic
No off target data available for this crispr