ID: 942123114

View in Genome Browser
Species Human (GRCh38)
Location 2:172798145-172798167
Sequence AAGCCAGTGCTGTACTTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942123114_942123115 1 Left 942123114 2:172798145-172798167 CCTCTAAAGTACAGCACTGGCTT No data
Right 942123115 2:172798169-172798191 ATTTTCATTAGTCACCTCTGAGG No data
942123114_942123116 8 Left 942123114 2:172798145-172798167 CCTCTAAAGTACAGCACTGGCTT No data
Right 942123116 2:172798176-172798198 TTAGTCACCTCTGAGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942123114 Original CRISPR AAGCCAGTGCTGTACTTTAG AGG (reversed) Intronic
No off target data available for this crispr