ID: 942123115

View in Genome Browser
Species Human (GRCh38)
Location 2:172798169-172798191
Sequence ATTTTCATTAGTCACCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942123114_942123115 1 Left 942123114 2:172798145-172798167 CCTCTAAAGTACAGCACTGGCTT No data
Right 942123115 2:172798169-172798191 ATTTTCATTAGTCACCTCTGAGG No data
942123113_942123115 2 Left 942123113 2:172798144-172798166 CCCTCTAAAGTACAGCACTGGCT No data
Right 942123115 2:172798169-172798191 ATTTTCATTAGTCACCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942123115 Original CRISPR ATTTTCATTAGTCACCTCTG AGG Intronic
No off target data available for this crispr