ID: 942130273

View in Genome Browser
Species Human (GRCh38)
Location 2:172871913-172871935
Sequence CTGTGTGACTCCAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942130273_942130277 17 Left 942130273 2:172871913-172871935 CCAACTTGCTTGGAGTCACACAG No data
Right 942130277 2:172871953-172871975 CCAGCTTCAAGTCTGATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942130273 Original CRISPR CTGTGTGACTCCAAGCAAGT TGG (reversed) Intronic
No off target data available for this crispr