ID: 942132004

View in Genome Browser
Species Human (GRCh38)
Location 2:172889545-172889567
Sequence TAATTCCCACTCACAGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942132003_942132004 -1 Left 942132003 2:172889523-172889545 CCACAGAGGTCATTTCTTCTAGT No data
Right 942132004 2:172889545-172889567 TAATTCCCACTCACAGAACGAGG No data
942132002_942132004 0 Left 942132002 2:172889522-172889544 CCCACAGAGGTCATTTCTTCTAG No data
Right 942132004 2:172889545-172889567 TAATTCCCACTCACAGAACGAGG No data
942132001_942132004 8 Left 942132001 2:172889514-172889536 CCTCTTCTCCCACAGAGGTCATT No data
Right 942132004 2:172889545-172889567 TAATTCCCACTCACAGAACGAGG No data
942131999_942132004 22 Left 942131999 2:172889500-172889522 CCAAATAACAAATGCCTCTTCTC No data
Right 942132004 2:172889545-172889567 TAATTCCCACTCACAGAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942132004 Original CRISPR TAATTCCCACTCACAGAACG AGG Intronic
No off target data available for this crispr