ID: 942132710

View in Genome Browser
Species Human (GRCh38)
Location 2:172896803-172896825
Sequence GTTGTTCATCAGTTCACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942132709_942132710 2 Left 942132709 2:172896778-172896800 CCTGGAAATTCTATATATATGCA No data
Right 942132710 2:172896803-172896825 GTTGTTCATCAGTTCACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942132710 Original CRISPR GTTGTTCATCAGTTCACTGT TGG Intronic
No off target data available for this crispr