ID: 942139534

View in Genome Browser
Species Human (GRCh38)
Location 2:172964227-172964249
Sequence GGGCAGTCCTGGAAATATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942139529_942139534 15 Left 942139529 2:172964189-172964211 CCACTGAAGCTCTAATGTGCGGG No data
Right 942139534 2:172964227-172964249 GGGCAGTCCTGGAAATATAATGG No data
942139527_942139534 16 Left 942139527 2:172964188-172964210 CCCACTGAAGCTCTAATGTGCGG No data
Right 942139534 2:172964227-172964249 GGGCAGTCCTGGAAATATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942139534 Original CRISPR GGGCAGTCCTGGAAATATAA TGG Intronic
No off target data available for this crispr