ID: 942141462

View in Genome Browser
Species Human (GRCh38)
Location 2:172981318-172981340
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942141457_942141462 16 Left 942141457 2:172981279-172981301 CCTATTACGCCTACCTTGAGACT No data
Right 942141462 2:172981318-172981340 CTATAGTAGTAGATGGATGAAGG No data
942141458_942141462 7 Left 942141458 2:172981288-172981310 CCTACCTTGAGACTTTCGCATTA No data
Right 942141462 2:172981318-172981340 CTATAGTAGTAGATGGATGAAGG No data
942141459_942141462 3 Left 942141459 2:172981292-172981314 CCTTGAGACTTTCGCATTAGCTG No data
Right 942141462 2:172981318-172981340 CTATAGTAGTAGATGGATGAAGG No data
942141456_942141462 23 Left 942141456 2:172981272-172981294 CCATAATCCTATTACGCCTACCT No data
Right 942141462 2:172981318-172981340 CTATAGTAGTAGATGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr