ID: 942143512

View in Genome Browser
Species Human (GRCh38)
Location 2:173001868-173001890
Sequence CAGGCCCACCTCCAGCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942143504_942143512 0 Left 942143504 2:173001845-173001867 CCCATGAACCAAACACCTCCCAC 0: 13
1: 733
2: 3689
3: 6321
4: 10181
Right 942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG No data
942143501_942143512 5 Left 942143501 2:173001840-173001862 CCACCCCCATGAACCAAACACCT No data
Right 942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG No data
942143507_942143512 -8 Left 942143507 2:173001853-173001875 CCAAACACCTCCCACCAGGCCCA 0: 28
1: 667
2: 2564
3: 4964
4: 6216
Right 942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG No data
942143503_942143512 1 Left 942143503 2:173001844-173001866 CCCCATGAACCAAACACCTCCCA 0: 14
1: 838
2: 3953
3: 6925
4: 11627
Right 942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG No data
942143502_942143512 2 Left 942143502 2:173001843-173001865 CCCCCATGAACCAAACACCTCCC 0: 14
1: 689
2: 3402
3: 6086
4: 10642
Right 942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG No data
942143505_942143512 -1 Left 942143505 2:173001846-173001868 CCATGAACCAAACACCTCCCACC 0: 9
1: 602
2: 3492
3: 6308
4: 8835
Right 942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG No data
942143500_942143512 21 Left 942143500 2:173001824-173001846 CCAAGACACGAGGGGTCCACCCC No data
Right 942143512 2:173001868-173001890 CAGGCCCACCTCCAGCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942143512 Original CRISPR CAGGCCCACCTCCAGCATTG AGG Intronic
No off target data available for this crispr