ID: 942143994

View in Genome Browser
Species Human (GRCh38)
Location 2:173007884-173007906
Sequence TGCTGAGTAATATAGCTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942143994_942143998 17 Left 942143994 2:173007884-173007906 CCTATAAGCTATATTACTCAGCA No data
Right 942143998 2:173007924-173007946 CAAGCCCCTTCTGTAAAATAGGG No data
942143994_942143997 16 Left 942143994 2:173007884-173007906 CCTATAAGCTATATTACTCAGCA No data
Right 942143997 2:173007923-173007945 CCAAGCCCCTTCTGTAAAATAGG No data
942143994_942143999 18 Left 942143994 2:173007884-173007906 CCTATAAGCTATATTACTCAGCA No data
Right 942143999 2:173007925-173007947 AAGCCCCTTCTGTAAAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942143994 Original CRISPR TGCTGAGTAATATAGCTTAT AGG (reversed) Intronic
No off target data available for this crispr