ID: 942143999

View in Genome Browser
Species Human (GRCh38)
Location 2:173007925-173007947
Sequence AAGCCCCTTCTGTAAAATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942143993_942143999 25 Left 942143993 2:173007877-173007899 CCTGTGTCCTATAAGCTATATTA No data
Right 942143999 2:173007925-173007947 AAGCCCCTTCTGTAAAATAGGGG No data
942143994_942143999 18 Left 942143994 2:173007884-173007906 CCTATAAGCTATATTACTCAGCA No data
Right 942143999 2:173007925-173007947 AAGCCCCTTCTGTAAAATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942143999 Original CRISPR AAGCCCCTTCTGTAAAATAG GGG Intronic
No off target data available for this crispr