ID: 942145005

View in Genome Browser
Species Human (GRCh38)
Location 2:173018253-173018275
Sequence CACACAGGAGGGCTTCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942145005_942145010 -8 Left 942145005 2:173018253-173018275 CCAGGCGGAAGCCCTCCTGTGTG No data
Right 942145010 2:173018268-173018290 CCTGTGTGCAGAGAGGTGAATGG No data
942145005_942145011 14 Left 942145005 2:173018253-173018275 CCAGGCGGAAGCCCTCCTGTGTG No data
Right 942145011 2:173018290-173018312 GTGTCTCCCCACTGCCACACAGG No data
942145005_942145012 15 Left 942145005 2:173018253-173018275 CCAGGCGGAAGCCCTCCTGTGTG No data
Right 942145012 2:173018291-173018313 TGTCTCCCCACTGCCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942145005 Original CRISPR CACACAGGAGGGCTTCCGCC TGG (reversed) Intronic
No off target data available for this crispr