ID: 942147432

View in Genome Browser
Species Human (GRCh38)
Location 2:173040444-173040466
Sequence CAGCACCTGGGCCTTGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942147432_942147439 6 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147439 2:173040473-173040495 GCTGGCAGCCTCTGTGGGGCTGG No data
942147432_942147436 0 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147436 2:173040467-173040489 AGCAGAGCTGGCAGCCTCTGTGG No data
942147432_942147437 1 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147437 2:173040468-173040490 GCAGAGCTGGCAGCCTCTGTGGG No data
942147432_942147444 15 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147444 2:173040482-173040504 CTCTGTGGGGCTGGTGGGCTGGG No data
942147432_942147438 2 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147438 2:173040469-173040491 CAGAGCTGGCAGCCTCTGTGGGG No data
942147432_942147441 10 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147441 2:173040477-173040499 GCAGCCTCTGTGGGGCTGGTGGG No data
942147432_942147440 9 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147440 2:173040476-173040498 GGCAGCCTCTGTGGGGCTGGTGG No data
942147432_942147445 26 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147445 2:173040493-173040515 TGGTGGGCTGGGTCCCCAGAAGG No data
942147432_942147443 14 Left 942147432 2:173040444-173040466 CCATCGTCAAGGCCCAGGTGCTG No data
Right 942147443 2:173040481-173040503 CCTCTGTGGGGCTGGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942147432 Original CRISPR CAGCACCTGGGCCTTGACGA TGG (reversed) Intronic