ID: 942148644

View in Genome Browser
Species Human (GRCh38)
Location 2:173052179-173052201
Sequence CAACATCTTGATTTGGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942148644 Original CRISPR CAACATCTTGATTTGGAGCC TGG Exonic
904448123 1:30591008-30591030 CCTCTTCTTGATTTGGAGCAGGG + Intergenic
904654722 1:32036004-32036026 CAACACCTAGATTTTGAGACAGG + Intronic
905405456 1:37729424-37729446 CAAGACCTTGATTTGGGGCTGGG + Intronic
912579924 1:110711366-110711388 CAACATGTGCATTTGGAGACAGG - Intergenic
912603773 1:110966327-110966349 CAACATCTTGATTAGAATCAAGG - Intergenic
914450676 1:147788673-147788695 GAACGTTTGGATTTGGAGCCTGG - Intergenic
914679125 1:149926760-149926782 CAACATTTTCATTGGGAACCTGG - Exonic
917736359 1:177924283-177924305 CATGCTCTTGATTTGGAGGCAGG - Intronic
919789003 1:201277965-201277987 CACCATCTTGCTCTGGAGCAAGG - Intergenic
922651804 1:227346642-227346664 GGATTTCTTGATTTGGAGCCTGG - Intergenic
1065361005 10:24889033-24889055 CAACATCTGAATTTGGGGCAGGG - Intronic
1067657599 10:48208504-48208526 CAAGTTCCTGCTTTGGAGCCAGG + Intronic
1070500915 10:77071657-77071679 CAACATCTTTATTTGTAAGCTGG + Intronic
1074049919 10:109872324-109872346 CAGCATCTGGCCTTGGAGCCAGG + Intronic
1074368538 10:112879678-112879700 CAAAATATTGATTTGAAGCCAGG - Intergenic
1075263990 10:120985283-120985305 CAACATCTAAATTTGGGGCAGGG + Intergenic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1078893993 11:15581908-15581930 GAAGATCTAGATTTGGACCCCGG - Intergenic
1078921388 11:15834197-15834219 CAACACCTAGATTTGCAACCTGG - Intergenic
1081975894 11:47234570-47234592 CAGCATCTGGTTTTGTAGCCTGG + Exonic
1083860930 11:65419570-65419592 CCACATCTTGTTCTGAAGCCAGG - Intergenic
1085322644 11:75584076-75584098 CAACATCTTCATTTGCAAGCCGG - Intergenic
1088247861 11:107836707-107836729 CAACACTTTGATTTTTAGCCCGG + Intronic
1089669196 11:120040735-120040757 CAACATATGAATTTGGGGCCGGG - Intergenic
1090819095 11:130325100-130325122 CTATATCTTGATTTTAAGCCAGG - Intergenic
1091209827 11:133846603-133846625 AAACATTTTGATTTGGAGGTTGG - Intergenic
1094549994 12:31441640-31441662 CAACAACTTCATTTGGAGCTGGG - Intronic
1095436968 12:42200215-42200237 AAATGTCTTGATTTGGAGCACGG - Intronic
1095670400 12:44853071-44853093 TAAGAACTTGATTTGGAGCATGG - Intronic
1095835038 12:46628615-46628637 AGACCTCCTGATTTGGAGCCAGG - Intergenic
1097748734 12:63329034-63329056 CCAGTTCTTTATTTGGAGCCTGG - Intergenic
1098318679 12:69218143-69218165 CAGCATCATGCTTTGGACCCAGG + Intergenic
1098589424 12:72192619-72192641 CAAGACCTGGATTTGAAGCCTGG + Intronic
1098917311 12:76270960-76270982 CAACTTTATGATTTGGAGCTAGG + Intergenic
1100213100 12:92418529-92418551 GAACAACTTGATGTGGAGCCTGG - Intergenic
1103542527 12:121676079-121676101 CAATATCTTGCTTTGTACCCAGG + Intergenic
1105469545 13:20680602-20680624 CAACTTCTTGATCTGGCCCCAGG + Intronic
1106331825 13:28746413-28746435 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1107725606 13:43296156-43296178 CAACATTTGGATTTGGGGCTGGG - Intronic
1109823552 13:67688308-67688330 CAACATCTTGATTTCAGGCTTGG - Intergenic
1111093521 13:83478355-83478377 CACCATCTTGGTTTGTACCCAGG + Intergenic
1112301663 13:98236222-98236244 AAAAACCTTGATTTGTAGCCGGG + Intronic
1114065753 14:19058871-19058893 GGAGATCTTGATTTGGAGCAGGG - Intergenic
1114584266 14:23795449-23795471 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1114747153 14:25161508-25161530 CATCATATTGATCTGGGGCCTGG + Intergenic
1116087543 14:40259841-40259863 CCACCTCTTGATTTTGAGCTTGG + Intergenic
1116246774 14:42425707-42425729 TAAAATCTTGATTTTGAACCTGG - Intergenic
1116329936 14:43583028-43583050 CACCATCTTGAATAGGAGCTGGG + Intergenic
1118784488 14:69034648-69034670 CCACATCTTGATTTGGGGTATGG + Intergenic
1119865666 14:77971422-77971444 CTACATTTTCATTTGGAGCTCGG - Intergenic
1119934217 14:78575830-78575852 GAACATCTTGCTTTGGTCCCTGG - Intronic
1120208238 14:81609038-81609060 GAATATCTGGATTTGGGGCCAGG - Intergenic
1120520143 14:85517773-85517795 TAACATATTCTTTTGGAGCCAGG - Intergenic
1120959687 14:90113481-90113503 CACCATCTTCAATTGGATCCTGG + Intronic
1121246067 14:92461693-92461715 CAACATATGAATTTGGAGGCGGG + Intronic
1126371670 15:47953652-47953674 CAACACCTTGATTTTTAGCTCGG - Intergenic
1126607903 15:50498510-50498532 TAACATCTAGATTTTTAGCCAGG - Intronic
1130237613 15:82151380-82151402 CAAAATCTTGTTTTTGAGACAGG - Intronic
1133047761 16:3098719-3098741 GAGCAGCTTAATTTGGAGCCCGG + Intronic
1133073677 16:3263808-3263830 CAACTTCTTGTTTATGAGCCTGG + Intronic
1133441404 16:5824042-5824064 CAATATCTTGATTCGAAACCAGG - Intergenic
1134634459 16:15781659-15781681 AAACTTTTTGCTTTGGAGCCTGG + Intronic
1138073656 16:54019101-54019123 CTACATCTGGATGTGGTGCCTGG - Intronic
1144784155 17:17822679-17822701 CACCAGCTTGAAGTGGAGCCTGG + Intronic
1146924361 17:36733865-36733887 CAACATCTGGATTTGAACTCAGG - Intergenic
1148254717 17:46119737-46119759 GAACTTAGTGATTTGGAGCCTGG - Intronic
1149588229 17:57807984-57808006 CAACATCTTGATTTTAGCCCAGG + Intergenic
1150344982 17:64397729-64397751 CAACATCTTTTTTTTGAGACAGG + Intronic
1150479571 17:65499078-65499100 TAAGATCTAGATTGGGAGCCTGG + Intergenic
1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG + Intergenic
1152948638 17:83212416-83212438 CAACATCAAGAGTTGGGGCCTGG + Intergenic
1153197269 18:2614409-2614431 CAGCATCTTGCTCTGTAGCCAGG - Intronic
1153863925 18:9244478-9244500 CAAAATCTTGAGTTAGAGCTGGG - Intronic
1154348004 18:13559924-13559946 CAACATCTTGGTTTGAAGATAGG - Intronic
1156684142 18:39623799-39623821 CAGCATCTTGTTTTGAAGCATGG + Intergenic
1159563256 18:70018534-70018556 CAACATCTTGATTTTGGTCTAGG - Intronic
1161443404 19:4304946-4304968 CCACATCTTGGCTTGGGGCCAGG + Intronic
1163357439 19:16823279-16823301 CAACATCTTGAATAGGGGCTGGG + Intergenic
1164018231 19:21272330-21272352 AAAAATCTTGTTTTGGAGCTCGG + Intronic
1164950572 19:32333396-32333418 TGACATCTTAATTTGGAGCAGGG - Intergenic
1166559628 19:43723589-43723611 CAACACCATGATCTGCAGCCTGG - Intergenic
1168074055 19:53969560-53969582 CAGCATCTGGATTTGAATCCAGG + Intronic
1168704717 19:58463312-58463334 CAACTTCTTTATTTTGAGACAGG - Intergenic
1168720957 19:58554834-58554856 CACCACCTTGCTTTGGTGCCGGG - Intronic
925670098 2:6302123-6302145 CAGCATCCTGATTTGAAGCCTGG + Intergenic
925934800 2:8746031-8746053 TAAAATCTTCATTTAGAGCCTGG - Intronic
928021713 2:27710437-27710459 CAAGATCTTGATTTAGGGCCAGG - Intronic
931380765 2:61751199-61751221 CAACCTCTTTATTTGAAGACAGG + Intergenic
931380815 2:61751536-61751558 AACCATCTTAATTTGGGGCCAGG + Intergenic
939047575 2:137267970-137267992 CAATATCATGGTTTGAAGCCAGG - Intronic
941160445 2:162028892-162028914 CAACAGCTTGAATTGAATCCCGG - Intronic
942102182 2:172595092-172595114 CAATATCTTGCTTTGTTGCCAGG + Intronic
942148644 2:173052179-173052201 CAACATCTTGATTTGGAGCCTGG + Exonic
945246526 2:207722439-207722461 GCACATCTTGATTTGGGGCGGGG + Intronic
947164291 2:227246135-227246157 CAACAGCATAATTTGGAGGCAGG + Intronic
947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG + Intergenic
947615946 2:231557118-231557140 CAGCAACTGGGTTTGGAGCCGGG - Intergenic
947763316 2:232619733-232619755 CAAAATGGTGAATTGGAGCCTGG + Intronic
948404789 2:237709213-237709235 CATCATCTTGAGCTGGAGCTAGG + Intronic
1169644145 20:7790541-7790563 TAAGATCTTGAATTGGATCCTGG + Intergenic
1175938405 20:62525816-62525838 CCACACCTTGATTTTGACCCAGG - Intergenic
1176196854 20:63840893-63840915 CAACAACTTGATGTCAAGCCAGG + Intergenic
1177254609 21:18644946-18644968 CAACACCTTGATTTGGACTCTGG - Intergenic
1178130932 21:29572069-29572091 AAACATGTTCATGTGGAGCCAGG + Intronic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
950787096 3:15445973-15445995 ACACATCTGGATTTGAAGCCTGG - Intronic
951232285 3:20193116-20193138 CAATATCCTGAATTGGATCCCGG - Intergenic
951650974 3:24951198-24951220 TAACACCATGACTTGGAGCCTGG - Intergenic
952229885 3:31418899-31418921 CACCCTATTGATTTGGAGCTTGG - Intergenic
954408500 3:50358877-50358899 CAACTTCTGGATCTGGACCCTGG - Exonic
955045075 3:55352093-55352115 TCACATCTTGTTTTGGATCCTGG + Intergenic
955543102 3:59998982-59999004 CCATAACTTGCTTTGGAGCCCGG - Intronic
956130762 3:66051781-66051803 GAACATCTTGATTTAGAGCATGG + Intergenic
956648547 3:71481429-71481451 CTACATCTTAACTTGGATCCTGG + Intronic
958421424 3:93936104-93936126 CAACATATGAATTTGGAGCGGGG - Intronic
958453170 3:94298776-94298798 AAACATCATGATCTGCAGCCTGG + Intergenic
966148601 3:176840919-176840941 CAAGACCTTGATTTGGAACTGGG + Intergenic
969217013 4:5730937-5730959 CAGCTTCTTGATTAGGAGCGTGG + Intronic
969526793 4:7707928-7707950 AAGCATCCTGATTTGGAGACGGG - Intronic
969880590 4:10170247-10170269 CAACTTCTTGATGTGGCCCCAGG + Intergenic
970229918 4:13899240-13899262 CCAGGTCTTGATTTGGAGCCAGG - Intergenic
974355715 4:60810193-60810215 CAACATATTAATTTTGAGGCAGG - Intergenic
976624271 4:87162346-87162368 CTACATATTGATTTGAAGCCAGG - Exonic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
980039288 4:127920792-127920814 CAGCATCTGGAAGTGGAGCCCGG - Exonic
980929141 4:139168861-139168883 CAAAATCTTTCTTTGGACCCAGG - Intronic
982339644 4:154283770-154283792 CAACATCTTGATTGTGGACCTGG + Intronic
983574700 4:169248539-169248561 CATCATCTAGATTTTAAGCCTGG - Intronic
983732956 4:171020747-171020769 CATCATCTTGAATAGGAGCTGGG + Intergenic
984924176 4:184792150-184792172 CAACATCTTGACATGTAACCTGG + Intronic
985880925 5:2638569-2638591 GAAAATCTTCATTTGGAGGCGGG + Intergenic
986205127 5:5616858-5616880 CATCACCTTGATTTTTAGCCAGG + Intergenic
987468778 5:18304986-18305008 CATCTTCTTGATTTTGACCCAGG - Intergenic
988994433 5:36701105-36701127 CACAAGCTTGATGTGGAGCCAGG + Intergenic
989667096 5:43867250-43867272 CACCACCTTGAATTGGAGCAGGG + Intergenic
990012493 5:51017161-51017183 TAACTTCTTGACTTGGAGCAGGG - Intergenic
990943920 5:61230442-61230464 CAACATATTGATTTGGGGGGAGG - Intergenic
991301139 5:65130277-65130299 CAACATATGAATTTGGGGCCTGG + Intergenic
993918776 5:93773964-93773986 CAAGGTCTTGCTTTGTAGCCTGG + Intronic
994579009 5:101614751-101614773 ATACCTCTTGATTTGGATCCTGG + Intergenic
995878673 5:116819683-116819705 CAAAATCATGATTGTGAGCCGGG + Intergenic
997702690 5:135914970-135914992 CAAAATCTTGATTTGAAGTCGGG - Intergenic
997706102 5:135954260-135954282 CAAGGTGTTGATTTGGAGCTTGG - Intronic
999229794 5:150054967-150054989 CAGCATCTTGCTCTGTAGCCCGG - Intronic
1000772498 5:165372884-165372906 CAAGATATTGATTTGCAGGCTGG - Intergenic
1001490080 5:172148888-172148910 CAACATCTCAATCTCGAGCCAGG + Intronic
1004690915 6:17991338-17991360 AAGCATTTGGATTTGGAGCCAGG + Intergenic
1005283826 6:24303057-24303079 CCACATCTTGATTTTGTCCCCGG + Intronic
1005713715 6:28526603-28526625 AAACAACTGGATTTGGAGTCAGG + Intronic
1007634041 6:43287421-43287443 CAACACCCTGGTTTGGAGCTGGG + Exonic
1010209442 6:73351591-73351613 CAAAATCTTGAGCAGGAGCCAGG + Intergenic
1014235917 6:118954742-118954764 CAACATATTTATTGGGTGCCAGG - Intergenic
1014944562 6:127481758-127481780 CTACATCTTGAATAGGAGCTGGG + Intronic
1015212539 6:130714555-130714577 CAACATCTGGATTTAAATCCTGG - Intergenic
1019138169 6:169925154-169925176 AAACATCTTGATAAAGAGCCAGG - Intergenic
1021235692 7:18139915-18139937 CAACACCTTGATTTTGGCCCAGG + Intronic
1022787366 7:33651998-33652020 CACCATCTTGATGTAGATCCAGG - Intergenic
1023629267 7:42147389-42147411 GATCATCTGGAATTGGAGCCGGG + Intronic
1024188727 7:46983160-46983182 CAGCAGCTTGGTTTGGAGCTGGG + Intergenic
1024691143 7:51804911-51804933 CAACATAATGATTTGGAGAAAGG - Intergenic
1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG + Intergenic
1026367877 7:69667649-69667671 CAAAATCTTGATTTTGGGCTGGG - Intronic
1026614515 7:71889551-71889573 CAAGGTCATGATTTGGAGGCGGG - Intronic
1030058668 7:105605502-105605524 CTACATCTTGAATTGGAAGCTGG - Exonic
1030211688 7:107002675-107002697 CAAGATCTTGCTTTGTTGCCAGG - Intergenic
1030214653 7:107032063-107032085 CAACATATGAATTTGGAGCAAGG - Intergenic
1030467098 7:109916183-109916205 GAACATCTGGATTTGGATCCTGG + Intergenic
1030686396 7:112491665-112491687 CAACATCCTGGTTTGAATCCTGG + Intergenic
1031163875 7:118203153-118203175 GAACATCTTGCTTTGGAGTTTGG - Intergenic
1032088176 7:128894410-128894432 CAACATATGGATTTGGGGGCGGG - Intronic
1032097029 7:128944111-128944133 GAATATCTTGATTTATAGCCTGG + Intronic
1034949494 7:155287358-155287380 CCACATCCTGTTTTGCAGCCAGG - Intergenic
1035551654 8:532374-532396 CATCATCTTGCTAGGGAGCCTGG - Intronic
1036939713 8:13039844-13039866 CAACATCTTTACTTTGTGCCTGG - Intergenic
1038718974 8:30016210-30016232 CCACAGCTTCCTTTGGAGCCCGG - Intergenic
1039059360 8:33561227-33561249 TGACATCTTGGTTAGGAGCCAGG + Intronic
1040536663 8:48316639-48316661 CAATGTCTGGAGTTGGAGCCTGG + Intergenic
1040704369 8:50107844-50107866 AAAAATCTTGATTTCTAGCCAGG - Intronic
1044243176 8:89911037-89911059 CAACACCTTGATTTTGGCCCAGG - Intronic
1044664833 8:94624312-94624334 GAAAATCTTGATTTGAATCCTGG + Intergenic
1047501295 8:125443845-125443867 CAACCTCTTGGATTGGAGCTTGG - Intergenic
1048935344 8:139350590-139350612 AATCATCTTAATTTGCAGCCTGG - Intergenic
1049995048 9:1026768-1026790 CGATATCCTGATTTGCAGCCTGG + Intergenic
1050417152 9:5429758-5429780 CAACATATGAATTTGGAGACAGG + Intronic
1050759479 9:9049399-9049421 CAACCTCTTTATTTGAAGACAGG + Intronic
1052773414 9:32710065-32710087 CAGCATCTTGAAGAGGAGCCGGG + Intergenic
1055312176 9:74993952-74993974 CAACATGTGAATTTGGAGGCAGG - Intronic
1055411563 9:76035399-76035421 CATCATCATGATTACGAGCCTGG - Intronic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1057287884 9:93775026-93775048 CAATATATTAATTTGGAGCGGGG - Intergenic
1057673533 9:97117984-97118006 CAACTTCCTGTTTTGCAGCCAGG - Intergenic
1058539058 9:105993143-105993165 CAAAATCATATTTTGGAGCCTGG + Intergenic
1059587695 9:115623728-115623750 TAACATCTAGATTTTGACCCAGG + Intergenic
1186714005 X:12231209-12231231 CAAAATATTTATTTGGGGCCTGG - Intronic
1188404525 X:29791275-29791297 CAACATCCTAAGTTGGATCCTGG + Intronic
1189187161 X:39064402-39064424 CAACATCTATATTTGCAGCAAGG + Intergenic
1189601202 X:42628544-42628566 TAACATCTTGCTTTGGAAGCAGG - Intergenic
1190255852 X:48761810-48761832 CCACATCTTGACTGGCAGCCTGG - Exonic
1190947589 X:55110910-55110932 CCCCATCTTGAATTGGAGCTGGG + Intronic
1194985230 X:100482931-100482953 GAAAATCTGGATTTGGATCCTGG - Intergenic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic
1198071337 X:133151498-133151520 CTACATATTCACTTGGAGCCAGG - Intergenic
1198845004 X:140900867-140900889 CACCATCTTGAATAGGAGCTGGG - Intergenic
1199087813 X:143649167-143649189 AAACATCTTTATTTGGAGGAAGG - Intergenic