ID: 942150193

View in Genome Browser
Species Human (GRCh38)
Location 2:173068492-173068514
Sequence ATTGGAGCTGGGCCCATGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942150182_942150193 21 Left 942150182 2:173068448-173068470 CCAAGGTGTAGGGGAAGATGTTG No data
Right 942150193 2:173068492-173068514 ATTGGAGCTGGGCCCATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942150193 Original CRISPR ATTGGAGCTGGGCCCATGCA CGG Intergenic
No off target data available for this crispr