ID: 942150894

View in Genome Browser
Species Human (GRCh38)
Location 2:173075626-173075648
Sequence GGCGAGGGGGAACACCCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942150894 Original CRISPR GGCGAGGGGGAACACCCCCA CGG Intronic
900156501 1:1205369-1205391 GGCCAGGGGGTACAGTCCCAGGG - Exonic
900364011 1:2303287-2303309 GGCGAGGGTGAACACAGCCCAGG - Exonic
909667472 1:78151420-78151442 GGTGGGGGGGAATTCCCCCAGGG - Intergenic
915651127 1:157311662-157311684 GCCCAGGCAGAACACCCCCAAGG + Intergenic
915660293 1:157399896-157399918 GCCCAGGCAGAACACCCCCAAGG - Intergenic
918016023 1:180632660-180632682 GGCGAGGGGGCGCTCGCCCAGGG - Intronic
919987527 1:202686151-202686173 GGCGAAGGGGGACCCCCACAGGG - Intronic
920387350 1:205578421-205578443 GGAGAGGGGGACCAACCTCAAGG - Intronic
920864980 1:209744382-209744404 GGGGAAGGCGAACAGCCCCACGG - Intergenic
921335816 1:214084859-214084881 GGCCAGGGAGAAAATCCCCATGG + Intergenic
922675157 1:227545040-227545062 GGGGTGGGGGCACACACCCAGGG - Intergenic
923678806 1:236102621-236102643 GGGGAGAGAAAACACCCCCAAGG - Intergenic
923730290 1:236543574-236543596 TGCAAGGTTGAACACCCCCATGG + Exonic
1067118287 10:43452489-43452511 GGCGTGGTGGCACACCCCCGTGG - Intronic
1067295282 10:44972101-44972123 GGAAAGGGGGAAGACCCCCAAGG - Intronic
1069711083 10:70489095-70489117 GGCAAGGGGCAACTCCCCAAGGG - Intronic
1074767147 10:116707726-116707748 GGTGAGGGGTACCTCCCCCAAGG + Intronic
1077962509 11:7089802-7089824 GGCGAGGGGGCAAAACCCCGGGG - Exonic
1078520704 11:12060769-12060791 GCTGAGGGGGAACAGCCCAATGG + Intergenic
1078671372 11:13368633-13368655 GCCGAGGGAAAACACACCCATGG - Intronic
1083161062 11:60854385-60854407 GGGGAGGAGGAACTCCCACATGG + Intronic
1085515068 11:77106991-77107013 GGGGAAGGGGGACTCCCCCAAGG + Intronic
1089202723 11:116734175-116734197 GGCCAGGGGGAACTCCACAAAGG + Intergenic
1092385577 12:8033506-8033528 GGGGGAGGGGAACTCCCCCAAGG + Exonic
1100565635 12:95790927-95790949 GGCGCGGGGGACCCCCCCCCCGG - Intronic
1114728517 14:24965230-24965252 GGAGAGGGAGAAAACCCCCAAGG + Intronic
1117056972 14:51922454-51922476 GGCGAGGGGGAAGACTCCAAGGG + Intronic
1117741960 14:58827945-58827967 GGCCAAGTGGAACAGCCCCAGGG - Intergenic
1125493189 15:40164365-40164387 GGCGTGGTGGTACACGCCCATGG - Intronic
1125541061 15:40470582-40470604 GGCAAGGGGGAGCACACCGAGGG + Intergenic
1130648953 15:85751427-85751449 GGCCCGGGGGGACACCCACAGGG - Intergenic
1132329765 15:101004107-101004129 GGGGAAGGGGCACACTCCCAGGG - Intronic
1132883079 16:2170908-2170930 GGAGTGGGGGAACATGCCCAGGG - Intronic
1134849956 16:17471113-17471135 GGCGAGGGGGACAATTCCCAAGG + Intergenic
1136725381 16:32353196-32353218 GGCCAGTGGGAACAGCTCCATGG + Intergenic
1139338200 16:66248311-66248333 GGGGAGGGGAAACCCACCCACGG + Intergenic
1141386018 16:83623211-83623233 GGAGAGGTGGCACACACCCAGGG + Intronic
1141575924 16:84963599-84963621 GACGAGGGGGACCAGCCGCAGGG - Intergenic
1141744027 16:85913941-85913963 GGCTAGGGGGAAGACGCCGAGGG - Intronic
1203001050 16_KI270728v1_random:164558-164580 GGCCAGTGGGAACAGCTCCATGG - Intergenic
1203132652 16_KI270728v1_random:1700962-1700984 GGCCAGTGGGAACAGCTCCATGG - Intergenic
1143377138 17:6473445-6473467 GGCGAGGAGGCAGAACCCCATGG - Intronic
1143385608 17:6528397-6528419 GGGGAGGGAGAACACCCTTAGGG - Intronic
1144705890 17:17367603-17367625 GGGGAGAGGAAACACCTCCAGGG - Intergenic
1144814123 17:18021393-18021415 GCAGAGGAGGATCACCCCCAGGG - Intronic
1146260052 17:31415157-31415179 GGCAAGGGGGAAGAGCCCCCCGG + Intronic
1148674670 17:49438490-49438512 GGCCAGGGGGCACGCCCCCTGGG + Intronic
1149899410 17:60459963-60459985 AGTGAGGGGGAAATCCCCCAAGG - Intronic
1152638672 17:81440580-81440602 GGAGAGGGACAGCACCCCCAGGG + Intronic
1153616348 18:6938195-6938217 GGCTGAGGGGAACACACCCAGGG + Intergenic
1157335270 18:46733137-46733159 TGGGAGGGGGAAGACCCCGAAGG + Intronic
1160809710 19:1008092-1008114 GGCCAGGTGGGACAGCCCCAGGG - Intronic
1162095492 19:8307575-8307597 GGCCAGGGCGAACACGTCCACGG + Intronic
1162470964 19:10871785-10871807 GGCGCCGGGGAACACCGACACGG - Exonic
1165068702 19:33242986-33243008 GGGGGAGGGGAGCACCCCCAGGG + Intergenic
1167238664 19:48330403-48330425 GGCGAGGGGGAAGGCCACCCAGG - Exonic
1167577230 19:50323564-50323586 GGCGAAGATGAGCACCCCCAGGG + Exonic
1168640630 19:58029186-58029208 GGCCAGGGGTAACAGCCCCCAGG + Intergenic
926139947 2:10362546-10362568 GGCGATGGGGAAGGCCTCCACGG + Intronic
928090162 2:28368979-28369001 GGGGAGCGGGAACCCCGCCAGGG + Intergenic
928190409 2:29160374-29160396 TGCGAGGGGGAACTCCGCCTCGG + Exonic
928193300 2:29193814-29193836 GGAGAGGAGGAACCCCCTCAGGG + Exonic
937894691 2:126969807-126969829 GGGGAGAGGGTAGACCCCCAAGG - Intergenic
940543442 2:155051721-155051743 AGCGGGGGAGACCACCCCCATGG + Intergenic
942150894 2:173075626-173075648 GGCGAGGGGGAACACCCCCACGG + Intronic
945113983 2:206392875-206392897 GGACAGGAGGAACAACCCCAGGG + Intergenic
946639943 2:221773426-221773448 TCCGAGGGGGAACATCCCCTTGG - Intergenic
948197866 2:236108442-236108464 GGCGTGGAGGAACACCCTCAGGG - Intronic
1169206867 20:3745545-3745567 GGCATGGGCGAACACCTCCAGGG - Exonic
1172169416 20:32920027-32920049 GGGGAAGGGAAACACCCTCATGG + Intronic
1175545027 20:59772666-59772688 GCCGAGTGGGGCCACCCCCAGGG + Intronic
1176236167 20:64054493-64054515 GGAGAGGGAGAACATCCTCAGGG + Intronic
1176985751 21:15433545-15433567 GGGGAGGTGGAACACCTCAAAGG + Intergenic
1179343141 21:40531450-40531472 GCAGAGGGGAAACACACCCAAGG - Intronic
1180051879 21:45335269-45335291 GGCGAGGGGGCACAGATCCAGGG - Intergenic
1180308751 22:11151421-11151443 GGCCAGTGGGAACAGCTCCATGG - Intergenic
1180547228 22:16513232-16513254 GGCCAGTGGGAACAGCTCCATGG - Intergenic
1180975338 22:19844972-19844994 GGCCAGGGGCACCAGCCCCAGGG - Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1183235090 22:36610881-36610903 GGGCACGGGGAAGACCCCCAAGG + Intronic
1184682090 22:46077952-46077974 GGCGGGGGGGAAAACCGCCCTGG - Intronic
1184694916 22:46133785-46133807 GGCGAGGCGGGACAACCACAGGG - Intergenic
950883656 3:16344484-16344506 GGCGAGGGGGAAGAAGGCCAGGG - Intronic
952792776 3:37213553-37213575 GGCGTGGTGGCACACACCCATGG - Intergenic
952889377 3:38030296-38030318 GCCGAGGGGGAGGATCCCCAGGG + Intergenic
953362367 3:42309287-42309309 GGCCTGGCAGAACACCCCCATGG - Intergenic
962815374 3:138992671-138992693 GGCCAGGGGGAACAGCCTGAAGG - Intergenic
968415804 4:432742-432764 GGCGGGGGGGAACTCTCTCAGGG - Intronic
973694954 4:53481719-53481741 GGAGAGGAGCAACACTCCCAAGG - Exonic
982157368 4:152535677-152535699 GGCGTGGGGCGAGACCCCCAAGG - Exonic
982198362 4:152937202-152937224 GGCGCGGGGGAAAAGCCTCACGG - Intronic
982260333 4:153488807-153488829 GGCGAGGGCGGACTCCCCGAGGG - Intronic
985256582 4:188076281-188076303 GCAGAGGGGGAACATCCCCAGGG + Intergenic
986052243 5:4101080-4101102 GACGAGGGGAAACACTTCCAGGG + Intergenic
986088826 5:4481443-4481465 GGCGAAAGGGAACTCTCCCAGGG + Intergenic
986241714 5:5965664-5965686 GTGTAGGGAGAACACCCCCATGG - Intergenic
987051094 5:14146717-14146739 GGGAAAGGGGAACAGCCCCAAGG - Intronic
997615507 5:135243675-135243697 GGCCAGAGGGAACACCCCATGGG + Intronic
1005987496 6:30884024-30884046 GGCAAAGGGGAGCAGCCCCAGGG - Intronic
1006146755 6:31963968-31963990 GGAGAAGGTGAACACCACCACGG - Exonic
1019577849 7:1746132-1746154 GGAGAGCGCGGACACCCCCAAGG + Exonic
1024231600 7:47367696-47367718 GGCTTGGGGGAACAGGCCCAGGG - Intronic
1024237282 7:47408150-47408172 GGCCATTGGGAACACTCCCAAGG + Intronic
1035242705 7:157542607-157542629 GGGCAGGGGGAACTCCACCAGGG + Intronic
1037994434 8:23342115-23342137 AGGGAGGGGGAACACCCACGTGG - Intronic
1040853461 8:51925319-51925341 GCAGAGGGGGAACATGCCCAGGG - Intergenic
1047305700 8:123651652-123651674 TGCGGGGTGGAGCACCCCCACGG + Exonic
1049281952 8:141753913-141753935 GGCAAGTGGGAACAGCCCCGTGG - Intergenic
1049697826 8:143992198-143992220 GGCATGGGGGCACACACCCAAGG + Intronic
1053397661 9:37788783-37788805 GGAGAGAGTGAACTCCCCCAAGG - Intronic
1054775806 9:69122390-69122412 GGGCAGGGCGAGCACCCCCAGGG - Intronic
1057972649 9:99572412-99572434 GGAGGAGGGGAACACCCACAGGG + Intergenic
1062295909 9:135826447-135826469 GGTGGGGGGGTACACACCCAGGG - Intronic
1190304657 X:49075114-49075136 GGTGAGTGGGAACAGCCCCTTGG - Exonic
1190753430 X:53381140-53381162 GGCGGGGTGGGACAGCCCCAGGG + Intronic
1192428134 X:71095392-71095414 GGTGAGGAGGAACACCACCGTGG + Intergenic
1194688957 X:96958037-96958059 GGGGAGGAGGAACTCCTCCAAGG - Exonic
1195619474 X:106938586-106938608 GGAGAAAGGGAACAGCCCCAGGG + Intronic
1200049679 X:153422132-153422154 GGCGAGGGGAACGACCCCCAGGG - Intergenic