ID: 942150958

View in Genome Browser
Species Human (GRCh38)
Location 2:173075795-173075817
Sequence ACCTCCCGGCGCGAAACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942150958_942150963 13 Left 942150958 2:173075795-173075817 CCAGCCGTTTCGCGCCGGGAGGT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 942150963 2:173075831-173075853 GCCGTGACTGTCTTCCTCATTGG 0: 1
1: 0
2: 1
3: 9
4: 124
942150958_942150966 28 Left 942150958 2:173075795-173075817 CCAGCCGTTTCGCGCCGGGAGGT 0: 1
1: 0
2: 0
3: 0
4: 18
Right 942150966 2:173075846-173075868 CTCATTGGCGCCGTGCAGAGAGG 0: 1
1: 0
2: 1
3: 3
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942150958 Original CRISPR ACCTCCCGGCGCGAAACGGC TGG (reversed) Intronic