ID: 942153312

View in Genome Browser
Species Human (GRCh38)
Location 2:173100671-173100693
Sequence TCTGTAGGGTTCCTGATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942153306_942153312 11 Left 942153306 2:173100637-173100659 CCTACATAGTAACAAACTCTTAG No data
Right 942153312 2:173100671-173100693 TCTGTAGGGTTCCTGATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942153312 Original CRISPR TCTGTAGGGTTCCTGATGTC TGG Intronic
No off target data available for this crispr