ID: 942166303

View in Genome Browser
Species Human (GRCh38)
Location 2:173244118-173244140
Sequence CTGGAGACGCAGCAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942166296_942166303 24 Left 942166296 2:173244071-173244093 CCATGGGTCCCAGGACACACTGA No data
Right 942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG No data
942166299_942166303 15 Left 942166299 2:173244080-173244102 CCAGGACACACTGAAACGGAATT No data
Right 942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG No data
942166298_942166303 16 Left 942166298 2:173244079-173244101 CCCAGGACACACTGAAACGGAAT No data
Right 942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942166303 Original CRISPR CTGGAGACGCAGCAAGTGGG AGG Intronic
No off target data available for this crispr