ID: 942166581

View in Genome Browser
Species Human (GRCh38)
Location 2:173246619-173246641
Sequence ATTCAAAAGCAGAATTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942166578_942166581 26 Left 942166578 2:173246570-173246592 CCAGCAGTTTTCTCACCAAGATC No data
Right 942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG No data
942166577_942166581 27 Left 942166577 2:173246569-173246591 CCCAGCAGTTTTCTCACCAAGAT No data
Right 942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG No data
942166579_942166581 11 Left 942166579 2:173246585-173246607 CCAAGATCTTTTTGAGACTTCGT No data
Right 942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942166581 Original CRISPR ATTCAAAAGCAGAATTAGGA AGG Intronic
No off target data available for this crispr