ID: 942178396

View in Genome Browser
Species Human (GRCh38)
Location 2:173355894-173355916
Sequence AGTCGCCGCCCCGGTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942178388_942178396 19 Left 942178388 2:173355852-173355874 CCCTCGCGGGGGTGGGTGCGATG No data
Right 942178396 2:173355894-173355916 AGTCGCCGCCCCGGTGGAGCTGG No data
942178389_942178396 18 Left 942178389 2:173355853-173355875 CCTCGCGGGGGTGGGTGCGATGG No data
Right 942178396 2:173355894-173355916 AGTCGCCGCCCCGGTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942178396 Original CRISPR AGTCGCCGCCCCGGTGGAGC TGG Intronic
No off target data available for this crispr