ID: 942181255

View in Genome Browser
Species Human (GRCh38)
Location 2:173383290-173383312
Sequence CTTACCTCCACCACCTCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942181255_942181260 3 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181260 2:173383316-173383338 TAAGCAAGGGGGCACTGTACTGG No data
942181255_942181259 -8 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181259 2:173383305-173383327 GAGGTAAGTTTTAAGCAAGGGGG No data
942181255_942181264 19 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181264 2:173383332-173383354 GTACTGGGTCTGTCTGGAGAGGG No data
942181255_942181262 13 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181262 2:173383326-173383348 GGCACTGTACTGGGTCTGTCTGG No data
942181255_942181261 4 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181261 2:173383317-173383339 AAGCAAGGGGGCACTGTACTGGG No data
942181255_942181258 -9 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181258 2:173383304-173383326 GGAGGTAAGTTTTAAGCAAGGGG No data
942181255_942181263 18 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181263 2:173383331-173383353 TGTACTGGGTCTGTCTGGAGAGG No data
942181255_942181257 -10 Left 942181255 2:173383290-173383312 CCTCGGGAGGTGGTGGAGGTAAG No data
Right 942181257 2:173383303-173383325 TGGAGGTAAGTTTTAAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942181255 Original CRISPR CTTACCTCCACCACCTCCCG AGG (reversed) Intergenic