ID: 942183460

View in Genome Browser
Species Human (GRCh38)
Location 2:173402474-173402496
Sequence GTGTATGAGGATAAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942183453_942183460 19 Left 942183453 2:173402432-173402454 CCAAACACTGATGTCGGCTCAAG No data
Right 942183460 2:173402474-173402496 GTGTATGAGGATAAAGTGGCTGG No data
942183456_942183460 -8 Left 942183456 2:173402459-173402481 CCTCGGAAAATGCCTGTGTATGA No data
Right 942183460 2:173402474-173402496 GTGTATGAGGATAAAGTGGCTGG No data
942183451_942183460 29 Left 942183451 2:173402422-173402444 CCGCGAATGGCCAAACACTGATG No data
Right 942183460 2:173402474-173402496 GTGTATGAGGATAAAGTGGCTGG No data
942183455_942183460 -5 Left 942183455 2:173402456-173402478 CCTCCTCGGAAAATGCCTGTGTA No data
Right 942183460 2:173402474-173402496 GTGTATGAGGATAAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942183460 Original CRISPR GTGTATGAGGATAAAGTGGC TGG Intergenic
No off target data available for this crispr