ID: 942190720

View in Genome Browser
Species Human (GRCh38)
Location 2:173466484-173466506
Sequence CTGTTACCTCAGTTGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4333
Summary {0: 1, 1: 2, 2: 57, 3: 627, 4: 3646}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942190719_942190720 -10 Left 942190719 2:173466471-173466493 CCTCTCTGTCTTTCTGTTACCTC 0: 1
1: 0
2: 7
3: 97
4: 1083
Right 942190720 2:173466484-173466506 CTGTTACCTCAGTTGTAAAATGG 0: 1
1: 2
2: 57
3: 627
4: 3646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942190720 Original CRISPR CTGTTACCTCAGTTGTAAAA TGG Intergenic
Too many off-targets to display for this crispr