ID: 942190720 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:173466484-173466506 |
Sequence | CTGTTACCTCAGTTGTAAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4333 | |||
Summary | {0: 1, 1: 2, 2: 57, 3: 627, 4: 3646} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
942190719_942190720 | -10 | Left | 942190719 | 2:173466471-173466493 | CCTCTCTGTCTTTCTGTTACCTC | 0: 1 1: 0 2: 7 3: 97 4: 1083 |
||
Right | 942190720 | 2:173466484-173466506 | CTGTTACCTCAGTTGTAAAATGG | 0: 1 1: 2 2: 57 3: 627 4: 3646 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
942190720 | Original CRISPR | CTGTTACCTCAGTTGTAAAA TGG | Intergenic | ||
Too many off-targets to display for this crispr |