ID: 942199471

View in Genome Browser
Species Human (GRCh38)
Location 2:173556480-173556502
Sequence CTTGGAAAGGGGTCCTCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942199471_942199480 13 Left 942199471 2:173556480-173556502 CCTTCGGAGGACCCCTTTCCAAG No data
Right 942199480 2:173556516-173556538 GGCGAAACTGTCAGAGAGAGAGG No data
942199471_942199478 -8 Left 942199471 2:173556480-173556502 CCTTCGGAGGACCCCTTTCCAAG No data
Right 942199478 2:173556495-173556517 TTTCCAAGAGGCTGAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942199471 Original CRISPR CTTGGAAAGGGGTCCTCCGA AGG (reversed) Intergenic
No off target data available for this crispr