ID: 942199478

View in Genome Browser
Species Human (GRCh38)
Location 2:173556495-173556517
Sequence TTTCCAAGAGGCTGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942199470_942199478 -4 Left 942199470 2:173556476-173556498 CCTTCCTTCGGAGGACCCCTTTC No data
Right 942199478 2:173556495-173556517 TTTCCAAGAGGCTGAGTGGGTGG No data
942199467_942199478 29 Left 942199467 2:173556443-173556465 CCGACTTTGTCATCGGCTTTGAA No data
Right 942199478 2:173556495-173556517 TTTCCAAGAGGCTGAGTGGGTGG No data
942199471_942199478 -8 Left 942199471 2:173556480-173556502 CCTTCGGAGGACCCCTTTCCAAG No data
Right 942199478 2:173556495-173556517 TTTCCAAGAGGCTGAGTGGGTGG No data
942199466_942199478 30 Left 942199466 2:173556442-173556464 CCCGACTTTGTCATCGGCTTTGA No data
Right 942199478 2:173556495-173556517 TTTCCAAGAGGCTGAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942199478 Original CRISPR TTTCCAAGAGGCTGAGTGGG TGG Intergenic
No off target data available for this crispr