ID: 942199480

View in Genome Browser
Species Human (GRCh38)
Location 2:173556516-173556538
Sequence GGCGAAACTGTCAGAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942199477_942199480 0 Left 942199477 2:173556493-173556515 CCTTTCCAAGAGGCTGAGTGGGT No data
Right 942199480 2:173556516-173556538 GGCGAAACTGTCAGAGAGAGAGG No data
942199479_942199480 -5 Left 942199479 2:173556498-173556520 CCAAGAGGCTGAGTGGGTGGCGA No data
Right 942199480 2:173556516-173556538 GGCGAAACTGTCAGAGAGAGAGG No data
942199473_942199480 2 Left 942199473 2:173556491-173556513 CCCCTTTCCAAGAGGCTGAGTGG No data
Right 942199480 2:173556516-173556538 GGCGAAACTGTCAGAGAGAGAGG No data
942199470_942199480 17 Left 942199470 2:173556476-173556498 CCTTCCTTCGGAGGACCCCTTTC No data
Right 942199480 2:173556516-173556538 GGCGAAACTGTCAGAGAGAGAGG No data
942199475_942199480 1 Left 942199475 2:173556492-173556514 CCCTTTCCAAGAGGCTGAGTGGG No data
Right 942199480 2:173556516-173556538 GGCGAAACTGTCAGAGAGAGAGG No data
942199471_942199480 13 Left 942199471 2:173556480-173556502 CCTTCGGAGGACCCCTTTCCAAG No data
Right 942199480 2:173556516-173556538 GGCGAAACTGTCAGAGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942199480 Original CRISPR GGCGAAACTGTCAGAGAGAG AGG Intergenic
No off target data available for this crispr