ID: 942205912

View in Genome Browser
Species Human (GRCh38)
Location 2:173620005-173620027
Sequence CCAGAGAAAAGGTAGATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942205912_942205918 10 Left 942205912 2:173620005-173620027 CCAAGGATCTACCTTTTCTCTGG No data
Right 942205918 2:173620038-173620060 TCAGAGAGGCTTCCCTGCGAAGG No data
942205912_942205923 24 Left 942205912 2:173620005-173620027 CCAAGGATCTACCTTTTCTCTGG No data
Right 942205923 2:173620052-173620074 CTGCGAAGGCAGGGCTTAGAAGG No data
942205912_942205924 25 Left 942205912 2:173620005-173620027 CCAAGGATCTACCTTTTCTCTGG No data
Right 942205924 2:173620053-173620075 TGCGAAGGCAGGGCTTAGAAGGG No data
942205912_942205917 -4 Left 942205912 2:173620005-173620027 CCAAGGATCTACCTTTTCTCTGG No data
Right 942205917 2:173620024-173620046 CTGGCATGAGGTGGTCAGAGAGG No data
942205912_942205919 14 Left 942205912 2:173620005-173620027 CCAAGGATCTACCTTTTCTCTGG No data
Right 942205919 2:173620042-173620064 AGAGGCTTCCCTGCGAAGGCAGG No data
942205912_942205920 15 Left 942205912 2:173620005-173620027 CCAAGGATCTACCTTTTCTCTGG No data
Right 942205920 2:173620043-173620065 GAGGCTTCCCTGCGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942205912 Original CRISPR CCAGAGAAAAGGTAGATCCT TGG (reversed) Intergenic
No off target data available for this crispr