ID: 942205916

View in Genome Browser
Species Human (GRCh38)
Location 2:173620016-173620038
Sequence ACCACCTCATGCCAGAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942205916_942205925 28 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205925 2:173620067-173620089 TTAGAAGGGTCTGTAAATGATGG No data
942205916_942205919 3 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205919 2:173620042-173620064 AGAGGCTTCCCTGCGAAGGCAGG No data
942205916_942205918 -1 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205918 2:173620038-173620060 TCAGAGAGGCTTCCCTGCGAAGG No data
942205916_942205923 13 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205923 2:173620052-173620074 CTGCGAAGGCAGGGCTTAGAAGG No data
942205916_942205920 4 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205920 2:173620043-173620065 GAGGCTTCCCTGCGAAGGCAGGG No data
942205916_942205926 29 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205926 2:173620068-173620090 TAGAAGGGTCTGTAAATGATGGG No data
942205916_942205924 14 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205924 2:173620053-173620075 TGCGAAGGCAGGGCTTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942205916 Original CRISPR ACCACCTCATGCCAGAGAAA AGG (reversed) Intergenic
No off target data available for this crispr