ID: 942205923

View in Genome Browser
Species Human (GRCh38)
Location 2:173620052-173620074
Sequence CTGCGAAGGCAGGGCTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942205916_942205923 13 Left 942205916 2:173620016-173620038 CCTTTTCTCTGGCATGAGGTGGT No data
Right 942205923 2:173620052-173620074 CTGCGAAGGCAGGGCTTAGAAGG No data
942205912_942205923 24 Left 942205912 2:173620005-173620027 CCAAGGATCTACCTTTTCTCTGG No data
Right 942205923 2:173620052-173620074 CTGCGAAGGCAGGGCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942205923 Original CRISPR CTGCGAAGGCAGGGCTTAGA AGG Intergenic
No off target data available for this crispr