ID: 942206214

View in Genome Browser
Species Human (GRCh38)
Location 2:173622099-173622121
Sequence GGTCCGTGTGTCAGTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942206214_942206218 13 Left 942206214 2:173622099-173622121 CCTGCAACACTGACACACGGACC No data
Right 942206218 2:173622135-173622157 AAAGCAGTCTAACTGTCCCAAGG No data
942206214_942206220 29 Left 942206214 2:173622099-173622121 CCTGCAACACTGACACACGGACC No data
Right 942206220 2:173622151-173622173 CCCAAGGCCACCATGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942206214 Original CRISPR GGTCCGTGTGTCAGTGTTGC AGG (reversed) Intergenic