ID: 942206214 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:173622099-173622121 |
| Sequence | GGTCCGTGTGTCAGTGTTGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942206214_942206218 | 13 | Left | 942206214 | 2:173622099-173622121 | CCTGCAACACTGACACACGGACC | No data | ||
| Right | 942206218 | 2:173622135-173622157 | AAAGCAGTCTAACTGTCCCAAGG | No data | ||||
| 942206214_942206220 | 29 | Left | 942206214 | 2:173622099-173622121 | CCTGCAACACTGACACACGGACC | No data | ||
| Right | 942206220 | 2:173622151-173622173 | CCCAAGGCCACCATGCTCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942206214 | Original CRISPR | GGTCCGTGTGTCAGTGTTGC AGG (reversed) | Intergenic | ||