ID: 942207728

View in Genome Browser
Species Human (GRCh38)
Location 2:173638192-173638214
Sequence AAGAAGAAGGAGGAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942207722_942207728 0 Left 942207722 2:173638169-173638191 CCAATTGAGTATCCATAATGAAG No data
Right 942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942207728 Original CRISPR AAGAAGAAGGAGGAGGAGGC AGG Intergenic
No off target data available for this crispr