ID: 942207910

View in Genome Browser
Species Human (GRCh38)
Location 2:173640710-173640732
Sequence CTGTTGTTCTGCATGACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942207910_942207911 -1 Left 942207910 2:173640710-173640732 CCATATGTCATGCAGAACAACAG No data
Right 942207911 2:173640732-173640754 GTTGCTTGATATTCCTCATCTGG No data
942207910_942207912 7 Left 942207910 2:173640710-173640732 CCATATGTCATGCAGAACAACAG No data
Right 942207912 2:173640740-173640762 ATATTCCTCATCTGGATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942207910 Original CRISPR CTGTTGTTCTGCATGACATA TGG (reversed) Intergenic
No off target data available for this crispr