ID: 942210424

View in Genome Browser
Species Human (GRCh38)
Location 2:173664232-173664254
Sequence TTGAAGAAGGCGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942210424_942210431 5 Left 942210424 2:173664232-173664254 CCCTCCTCCTCCGCCTTCTTCAA No data
Right 942210431 2:173664260-173664282 CTAGAGAACAGGAATGCAGTTGG No data
942210424_942210430 -6 Left 942210424 2:173664232-173664254 CCCTCCTCCTCCGCCTTCTTCAA No data
Right 942210430 2:173664249-173664271 CTTCAATAAAGCTAGAGAACAGG No data
942210424_942210432 21 Left 942210424 2:173664232-173664254 CCCTCCTCCTCCGCCTTCTTCAA No data
Right 942210432 2:173664276-173664298 CAGTTGGCCCTAGACAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942210424 Original CRISPR TTGAAGAAGGCGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr