ID: 942212879

View in Genome Browser
Species Human (GRCh38)
Location 2:173689168-173689190
Sequence CATGCAAAAGACTCTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942212879_942212880 13 Left 942212879 2:173689168-173689190 CCAGGTACAGAGTCTTTTGCATG No data
Right 942212880 2:173689204-173689226 AGTCCTCCCAGTGACCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942212879 Original CRISPR CATGCAAAAGACTCTGTACC TGG (reversed) Intergenic
No off target data available for this crispr