ID: 942214739

View in Genome Browser
Species Human (GRCh38)
Location 2:173707644-173707666
Sequence ATTTAACGAAGGAAGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942214739_942214747 14 Left 942214739 2:173707644-173707666 CCCAGAGGCTTCCTTCGTTAAAT No data
Right 942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG No data
942214739_942214742 -3 Left 942214739 2:173707644-173707666 CCCAGAGGCTTCCTTCGTTAAAT No data
Right 942214742 2:173707664-173707686 AATCAAGCCCGAACTCTGTGTGG No data
942214739_942214745 6 Left 942214739 2:173707644-173707666 CCCAGAGGCTTCCTTCGTTAAAT No data
Right 942214745 2:173707673-173707695 CGAACTCTGTGTGGATAATGAGG No data
942214739_942214746 7 Left 942214739 2:173707644-173707666 CCCAGAGGCTTCCTTCGTTAAAT No data
Right 942214746 2:173707674-173707696 GAACTCTGTGTGGATAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942214739 Original CRISPR ATTTAACGAAGGAAGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr