ID: 942214740

View in Genome Browser
Species Human (GRCh38)
Location 2:173707645-173707667
Sequence GATTTAACGAAGGAAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942214740_942214746 6 Left 942214740 2:173707645-173707667 CCAGAGGCTTCCTTCGTTAAATC No data
Right 942214746 2:173707674-173707696 GAACTCTGTGTGGATAATGAGGG No data
942214740_942214742 -4 Left 942214740 2:173707645-173707667 CCAGAGGCTTCCTTCGTTAAATC No data
Right 942214742 2:173707664-173707686 AATCAAGCCCGAACTCTGTGTGG No data
942214740_942214745 5 Left 942214740 2:173707645-173707667 CCAGAGGCTTCCTTCGTTAAATC No data
Right 942214745 2:173707673-173707695 CGAACTCTGTGTGGATAATGAGG No data
942214740_942214747 13 Left 942214740 2:173707645-173707667 CCAGAGGCTTCCTTCGTTAAATC No data
Right 942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG No data
942214740_942214748 30 Left 942214740 2:173707645-173707667 CCAGAGGCTTCCTTCGTTAAATC No data
Right 942214748 2:173707698-173707720 GAATGGCAAGAAATCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942214740 Original CRISPR GATTTAACGAAGGAAGCCTC TGG (reversed) Intergenic
No off target data available for this crispr