ID: 942214741

View in Genome Browser
Species Human (GRCh38)
Location 2:173707655-173707677
Sequence GTTCGGGCTTGATTTAACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942214741_942214747 3 Left 942214741 2:173707655-173707677 CCTTCGTTAAATCAAGCCCGAAC No data
Right 942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG No data
942214741_942214746 -4 Left 942214741 2:173707655-173707677 CCTTCGTTAAATCAAGCCCGAAC No data
Right 942214746 2:173707674-173707696 GAACTCTGTGTGGATAATGAGGG No data
942214741_942214748 20 Left 942214741 2:173707655-173707677 CCTTCGTTAAATCAAGCCCGAAC No data
Right 942214748 2:173707698-173707720 GAATGGCAAGAAATCCCTCTTGG No data
942214741_942214749 24 Left 942214741 2:173707655-173707677 CCTTCGTTAAATCAAGCCCGAAC No data
Right 942214749 2:173707702-173707724 GGCAAGAAATCCCTCTTGGAAGG No data
942214741_942214745 -5 Left 942214741 2:173707655-173707677 CCTTCGTTAAATCAAGCCCGAAC No data
Right 942214745 2:173707673-173707695 CGAACTCTGTGTGGATAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942214741 Original CRISPR GTTCGGGCTTGATTTAACGA AGG (reversed) Intergenic
No off target data available for this crispr