ID: 942214747

View in Genome Browser
Species Human (GRCh38)
Location 2:173707681-173707703
Sequence GTGTGGATAATGAGGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942214740_942214747 13 Left 942214740 2:173707645-173707667 CCAGAGGCTTCCTTCGTTAAATC No data
Right 942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG No data
942214739_942214747 14 Left 942214739 2:173707644-173707666 CCCAGAGGCTTCCTTCGTTAAAT No data
Right 942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG No data
942214741_942214747 3 Left 942214741 2:173707655-173707677 CCTTCGTTAAATCAAGCCCGAAC No data
Right 942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942214747 Original CRISPR GTGTGGATAATGAGGGAGAA TGG Intergenic
No off target data available for this crispr