ID: 942216143

View in Genome Browser
Species Human (GRCh38)
Location 2:173720716-173720738
Sequence GAGTCTCTGTTATCTTTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942216143_942216149 6 Left 942216143 2:173720716-173720738 CCGTGAAAAGATAACAGAGACTC No data
Right 942216149 2:173720745-173720767 ATCCATGGACAAGAAAGTTTGGG No data
942216143_942216147 -9 Left 942216143 2:173720716-173720738 CCGTGAAAAGATAACAGAGACTC No data
Right 942216147 2:173720730-173720752 CAGAGACTCTAGGGGATCCATGG No data
942216143_942216148 5 Left 942216143 2:173720716-173720738 CCGTGAAAAGATAACAGAGACTC No data
Right 942216148 2:173720744-173720766 GATCCATGGACAAGAAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942216143 Original CRISPR GAGTCTCTGTTATCTTTTCA CGG (reversed) Intergenic
No off target data available for this crispr