ID: 942216147

View in Genome Browser
Species Human (GRCh38)
Location 2:173720730-173720752
Sequence CAGAGACTCTAGGGGATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942216143_942216147 -9 Left 942216143 2:173720716-173720738 CCGTGAAAAGATAACAGAGACTC No data
Right 942216147 2:173720730-173720752 CAGAGACTCTAGGGGATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942216147 Original CRISPR CAGAGACTCTAGGGGATCCA TGG Intergenic
No off target data available for this crispr