ID: 942218577

View in Genome Browser
Species Human (GRCh38)
Location 2:173746898-173746920
Sequence GTGGTGTGAAGCAGGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942218570_942218577 22 Left 942218570 2:173746853-173746875 CCATATAGGTGAAGGTGGAAGAG No data
Right 942218577 2:173746898-173746920 GTGGTGTGAAGCAGGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942218577 Original CRISPR GTGGTGTGAAGCAGGCTCCA GGG Intergenic
No off target data available for this crispr