ID: 942221618

View in Genome Browser
Species Human (GRCh38)
Location 2:173774669-173774691
Sequence GGACACTCCTTGCCCAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942221618_942221619 -5 Left 942221618 2:173774669-173774691 CCAAAATTGGGCAAGGAGTGTCC No data
Right 942221619 2:173774687-173774709 TGTCCCAAGAGCCACCCCAGTGG No data
942221618_942221622 4 Left 942221618 2:173774669-173774691 CCAAAATTGGGCAAGGAGTGTCC No data
Right 942221622 2:173774696-173774718 AGCCACCCCAGTGGACCACGTGG No data
942221618_942221623 5 Left 942221618 2:173774669-173774691 CCAAAATTGGGCAAGGAGTGTCC No data
Right 942221623 2:173774697-173774719 GCCACCCCAGTGGACCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942221618 Original CRISPR GGACACTCCTTGCCCAATTT TGG (reversed) Intergenic
No off target data available for this crispr